ID: 1080322350_1080322352

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1080322350 1080322352
Species Human (GRCh38) Human (GRCh38)
Location 11:31026287-31026309 11:31026313-31026335
Sequence CCGTACCTTTACATAATGAAGAC ACATAGCAGAAACTACATAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 169} {0: 1, 1: 0, 2: 1, 3: 58, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!