ID: 1080333479_1080333484

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1080333479 1080333484
Species Human (GRCh38) Human (GRCh38)
Location 11:31169854-31169876 11:31169867-31169889
Sequence CCAACCTAGGTCTTGGAGAGACA TGGAGAGACAAAGATTTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 142} {0: 1, 1: 0, 2: 1, 3: 32, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!