|
Left Crispr |
Right Crispr |
Crispr ID |
1080351092 |
1080351095 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:31386555-31386577
|
11:31386572-31386594
|
Sequence |
CCAGCTGACTAAAGAGATGTTGG |
TGTTGGGCCTTGAACATCACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 2, 2: 31, 3: 224, 4: 496} |
{0: 1, 1: 0, 2: 2, 3: 46, 4: 479} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|