ID: 1080360626_1080360632

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1080360626 1080360632
Species Human (GRCh38) Human (GRCh38)
Location 11:31509525-31509547 11:31509540-31509562
Sequence CCCCAAAGAACCCTGGAGACCCT GAGACCCTCAACCAGGACACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 16, 4: 238} {0: 1, 1: 2, 2: 4, 3: 20, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!