|
Left Crispr |
Right Crispr |
| Crispr ID |
1080367825 |
1080367828 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:31597722-31597744
|
11:31597740-31597762
|
| Sequence |
CCACCACGCCAGGCTAGCTTTTG |
TTTTGTATTTTTCGTAGAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 64, 2: 2175, 3: 33044, 4: 148595} |
{0: 883, 1: 209258, 2: 144126, 3: 66958, 4: 41740} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|