ID: 1080367825_1080367829

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1080367825 1080367829
Species Human (GRCh38) Human (GRCh38)
Location 11:31597722-31597744 11:31597756-31597778
Sequence CCACCACGCCAGGCTAGCTTTTG GAGATGGCGTTTCATCATGTTGG
Strand - +
Off-target summary {0: 2, 1: 64, 2: 2175, 3: 33044, 4: 148595} {0: 16, 1: 3024, 2: 51249, 3: 107032, 4: 135179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!