ID: 1080376467_1080376473

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1080376467 1080376473
Species Human (GRCh38) Human (GRCh38)
Location 11:31718628-31718650 11:31718677-31718699
Sequence CCTCAACTGGAGCTGTCTTCCGG GACCTGGACTTCCTCACACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 113} {0: 1, 1: 0, 2: 0, 3: 19, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!