ID: 1080376904_1080376906

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1080376904 1080376906
Species Human (GRCh38) Human (GRCh38)
Location 11:31723383-31723405 11:31723409-31723431
Sequence CCCACAAACTTCACTTACAAAAC AATTCAATAATGAAATCATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 97, 4: 363} {0: 1, 1: 0, 2: 16, 3: 142, 4: 1671}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!