ID: 1080384699_1080384711

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1080384699 1080384711
Species Human (GRCh38) Human (GRCh38)
Location 11:31804445-31804467 11:31804487-31804509
Sequence CCCTCACCAAGGCGCGGGTGGGG GAGAAGTGACAGGCGTTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 105} {0: 1, 1: 0, 2: 3, 3: 15, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!