ID: 1080385475_1080385480

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1080385475 1080385480
Species Human (GRCh38) Human (GRCh38)
Location 11:31808493-31808515 11:31808506-31808528
Sequence CCTGAAGCTGCAAAGGAGTAGTA AGGAGTAGTAGGTGGGGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110} {0: 1, 1: 0, 2: 4, 3: 71, 4: 812}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!