|
Left Crispr |
Right Crispr |
| Crispr ID |
1080390938 |
1080390939 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:31845923-31845945
|
11:31845958-31845980
|
| Sequence |
CCATATGGTGACTATAGTTAACA |
CTTGAAAATTGCTAAGAAAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 14, 2: 44, 3: 113, 4: 272} |
{0: 1, 1: 20, 2: 62, 3: 162, 4: 2291} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|