ID: 1080402374_1080402383

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1080402374 1080402383
Species Human (GRCh38) Human (GRCh38)
Location 11:31947793-31947815 11:31947835-31947857
Sequence CCACTGCAGTTTGGCCCACAGGA GAGGGAGAGTACTACATCAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 225} {0: 18, 1: 172, 2: 283, 3: 310, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!