|
Left Crispr |
Right Crispr |
| Crispr ID |
1080402376 |
1080402383 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:31947808-31947830
|
11:31947835-31947857
|
| Sequence |
CCACAGGAAGCCACATCCATAGG |
GAGGGAGAGTACTACATCAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 5, 2: 10, 3: 19, 4: 179} |
{0: 18, 1: 172, 2: 283, 3: 310, 4: 438} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|