|
Left Crispr |
Right Crispr |
| Crispr ID |
1080402380 |
1080402383 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:31947818-31947840
|
11:31947835-31947857
|
| Sequence |
CCACATCCATAGGAAAAGAGGGA |
GAGGGAGAGTACTACATCAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 148, 2: 269, 3: 295, 4: 478} |
{0: 18, 1: 172, 2: 283, 3: 310, 4: 438} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|