ID: 1080407994_1080408001

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1080407994 1080408001
Species Human (GRCh38) Human (GRCh38)
Location 11:31997014-31997036 11:31997057-31997079
Sequence CCTGCCTGCTTTTATTCTGGCTG GTGCCCACCCGGACTGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 12, 3: 41, 4: 317} {0: 1, 1: 85, 2: 532, 3: 1058, 4: 1221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!