ID: 1080419936_1080419939

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1080419936 1080419939
Species Human (GRCh38) Human (GRCh38)
Location 11:32100796-32100818 11:32100818-32100840
Sequence CCTCATTCAGTGGAGAAGAGATG GAAAAGGCTGGCCCTACACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 203} {0: 1, 1: 0, 2: 1, 3: 11, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!