ID: 1080457468_1080457478

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1080457468 1080457478
Species Human (GRCh38) Human (GRCh38)
Location 11:32429718-32429740 11:32429759-32429781
Sequence CCTATGGGATCCTGGCAGGGCCA CTCCTGGCCCAGGACTGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 161} {0: 1, 1: 0, 2: 6, 3: 46, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!