ID: 1080457737_1080457757

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1080457737 1080457757
Species Human (GRCh38) Human (GRCh38)
Location 11:32431111-32431133 11:32431162-32431184
Sequence CCCCCGCCGGCGGCTGCAGAGAA GTGAGAGCTGAGGGGTGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120} {0: 1, 1: 0, 2: 3, 3: 32, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!