ID: 1080475249_1080475264

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1080475249 1080475264
Species Human (GRCh38) Human (GRCh38)
Location 11:32584083-32584105 11:32584136-32584158
Sequence CCTGGCCTCGATTCGCACCAGCT ACGCTTCACCGCCAGCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 67} {0: 1, 1: 0, 2: 1, 3: 12, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!