ID: 1080485789_1080485797

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1080485789 1080485797
Species Human (GRCh38) Human (GRCh38)
Location 11:32705098-32705120 11:32705125-32705147
Sequence CCAGTGCTGGGTGGCCGCACCAT CGGGAAACAGCAGTGGGGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96} {0: 1, 1: 0, 2: 5, 3: 28, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!