ID: 1080493069_1080493076

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1080493069 1080493076
Species Human (GRCh38) Human (GRCh38)
Location 11:32788562-32788584 11:32788588-32788610
Sequence CCTCCGGAGCTCATGAGATCCTC CCTCAGCCTCCCAAGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 73, 3: 1481, 4: 13660} {0: 92836, 1: 203589, 2: 246027, 3: 262461, 4: 302975}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!