ID: 1080503669_1080503681

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1080503669 1080503681
Species Human (GRCh38) Human (GRCh38)
Location 11:32892854-32892876 11:32892891-32892913
Sequence CCGCCGCCGTCGCCGCGAGTCCC CCGCTTCCCTGACGCCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 36, 4: 316} {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!