ID: 1080570571_1080570578

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1080570571 1080570578
Species Human (GRCh38) Human (GRCh38)
Location 11:33552974-33552996 11:33553025-33553047
Sequence CCAGGGAAAATCCCTGGGAAATG GAGATGAGGTTAGAAGCTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 232} {0: 1, 1: 1, 2: 2, 3: 16, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!