ID: 1080571187_1080571202

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1080571187 1080571202
Species Human (GRCh38) Human (GRCh38)
Location 11:33558493-33558515 11:33558532-33558554
Sequence CCTCCAGGGGCACCGGACAGGGC AGGAGGGTCTGGAGGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 205} {0: 1, 1: 0, 2: 6, 3: 157, 4: 2229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!