ID: 1080574247_1080574254

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1080574247 1080574254
Species Human (GRCh38) Human (GRCh38)
Location 11:33583848-33583870 11:33583891-33583913
Sequence CCTCCTTTCACCCATGAAAAGTA TTGGTAAGTAGCAGAACTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 175} {0: 1, 1: 0, 2: 3, 3: 21, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!