ID: 1080589966_1080589971

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1080589966 1080589971
Species Human (GRCh38) Human (GRCh38)
Location 11:33714407-33714429 11:33714448-33714470
Sequence CCTGTACAGGGCACTTACTGTGA GAAGTCAGTGAATGAGTGGTGGG
Strand - +
Off-target summary {0: 2, 1: 14, 2: 57, 3: 223, 4: 527} {0: 1, 1: 0, 2: 5, 3: 50, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!