ID: 1080593208_1080593222

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1080593208 1080593222
Species Human (GRCh38) Human (GRCh38)
Location 11:33742413-33742435 11:33742463-33742485
Sequence CCCACCTCATCCTCCCGAGTAGC CCAGCTCAGTATGGTTTTAATGG
Strand - +
Off-target summary {0: 53, 1: 7079, 2: 130875, 3: 286391, 4: 197429} {0: 1, 1: 0, 2: 0, 3: 5, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!