ID: 1080635273_1080635292

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1080635273 1080635292
Species Human (GRCh38) Human (GRCh38)
Location 11:34118255-34118277 11:34118308-34118330
Sequence CCACGTTGCCACCATGGAGGCCC GGGGTCCAGGAATCTGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106} {0: 1, 1: 0, 2: 12, 3: 169, 4: 679}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!