ID: 1080636364_1080636372

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1080636364 1080636372
Species Human (GRCh38) Human (GRCh38)
Location 11:34127297-34127319 11:34127316-34127338
Sequence CCCATCCCATTTTTGCCCTGCCA GCCAGGAAAAAGTAGAAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 228} {0: 1, 1: 0, 2: 3, 3: 45, 4: 439}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!