|
Left Crispr |
Right Crispr |
Crispr ID |
1080636449 |
1080636452 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:34128069-34128091
|
11:34128094-34128116
|
Sequence |
CCTGTAGCCAGGTGCAGTGGCTC |
ACCTGTAATCCCAGCACATTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 21, 2: 267, 3: 1054, 4: 2509} |
{0: 449, 1: 74928, 2: 305527, 3: 264699, 4: 238946} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|