|
Left Crispr |
Right Crispr |
| Crispr ID |
1080636449 |
1080636456 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:34128069-34128091
|
11:34128103-34128125
|
| Sequence |
CCTGTAGCCAGGTGCAGTGGCTC |
CCCAGCACATTGGGAGGCCGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 21, 2: 267, 3: 1054, 4: 2509} |
{0: 487, 1: 117495, 2: 263892, 3: 218538, 4: 229296} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|