ID: 1080636449_1080636458

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1080636449 1080636458
Species Human (GRCh38) Human (GRCh38)
Location 11:34128069-34128091 11:34128107-34128129
Sequence CCTGTAGCCAGGTGCAGTGGCTC GCACATTGGGAGGCCGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 21, 2: 267, 3: 1054, 4: 2509} {0: 363, 1: 86688, 2: 223496, 3: 237940, 4: 242372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!