ID: 1080638293_1080638307

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1080638293 1080638307
Species Human (GRCh38) Human (GRCh38)
Location 11:34142582-34142604 11:34142614-34142636
Sequence CCCCAAGGCTCCAGGTCACACCT CCAGGAGTGGGGGTGCCGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 232} {0: 1, 1: 0, 2: 2, 3: 14, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!