ID: 1080639295_1080639305

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1080639295 1080639305
Species Human (GRCh38) Human (GRCh38)
Location 11:34149466-34149488 11:34149490-34149512
Sequence CCCCCAAGCCTGCCTGTGGCTGC CATAGCAGGCGGAGCAGGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!