ID: 1080650028_1080650034

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1080650028 1080650034
Species Human (GRCh38) Human (GRCh38)
Location 11:34214987-34215009 11:34215013-34215035
Sequence CCTCATTCCAAGTATCTATCATC CCCCTTCGCCTGGCCCCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 153} {0: 1, 1: 1, 2: 2, 3: 34, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!