ID: 1080678564_1080678569

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1080678564 1080678569
Species Human (GRCh38) Human (GRCh38)
Location 11:34451071-34451093 11:34451093-34451115
Sequence CCCATCGCAGTTCGGTTCTCCAC CTGTTGGTAAGTTGGTTTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30} {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!