ID: 1080684264_1080684271

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1080684264 1080684271
Species Human (GRCh38) Human (GRCh38)
Location 11:34502483-34502505 11:34502514-34502536
Sequence CCTTGTTGATAAAAGACAGAAGG GCTAATCCTCCCACCTGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 270} {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!