ID: 1080760015_1080760020

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1080760015 1080760020
Species Human (GRCh38) Human (GRCh38)
Location 11:35239883-35239905 11:35239916-35239938
Sequence CCTGGAGGTGGTGAGATGTGCTT AACCCAGGGGAAACCCAGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!