ID: 1080766133_1080766136

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1080766133 1080766136
Species Human (GRCh38) Human (GRCh38)
Location 11:35298814-35298836 11:35298833-35298855
Sequence CCTGCAAGGGTTTAGTGGAAATC AATCACATTGGTATGGACATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 73} {0: 1, 1: 0, 2: 2, 3: 13, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!