ID: 1080787752_1080787757

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1080787752 1080787757
Species Human (GRCh38) Human (GRCh38)
Location 11:35491298-35491320 11:35491315-35491337
Sequence CCATCCTCCCTCTCTGTAAACTG AAACTGGAAATATCATTCATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 429} {0: 1, 1: 0, 2: 1, 3: 30, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!