ID: 1080820130_1080820136

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1080820130 1080820136
Species Human (GRCh38) Human (GRCh38)
Location 11:35797765-35797787 11:35797811-35797833
Sequence CCGAGAGGAGCCTATGGAAACTT GTGAAATCTGGAGCAGGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 76, 4: 394} {0: 1, 1: 1, 2: 2, 3: 44, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!