ID: 1080824281_1080824290

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1080824281 1080824290
Species Human (GRCh38) Human (GRCh38)
Location 11:35834865-35834887 11:35834884-35834906
Sequence CCCTCCACCTTCCCCCTGCTCAC TCACTGCTGTCTGGTCATGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!