ID: 1080836480_1080836486

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1080836480 1080836486
Species Human (GRCh38) Human (GRCh38)
Location 11:35944806-35944828 11:35944819-35944841
Sequence CCTGACCGGCGAGGGGCCCTGGG GGGCCCTGGGAGAGGACACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 216} {0: 1, 1: 0, 2: 4, 3: 46, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!