|
Left Crispr |
Right Crispr |
| Crispr ID |
1080850387 |
1080850391 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:36063429-36063451
|
11:36063457-36063479
|
| Sequence |
CCCTGGGAACCACTAATCCACTT |
CTCTACAGATTTGCCTATTCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 14, 2: 225, 3: 933, 4: 3021} |
{0: 39, 1: 236, 2: 824, 3: 1760, 4: 2292} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|