ID: 1080870308_1080870311

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1080870308 1080870311
Species Human (GRCh38) Human (GRCh38)
Location 11:36230919-36230941 11:36230965-36230987
Sequence CCCTCCGTGTATAGTCTCTATGT CTCTGTGTCCAGTCAGCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 69} {0: 1, 1: 0, 2: 0, 3: 18, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!