ID: 1080875880_1080875888

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1080875880 1080875888
Species Human (GRCh38) Human (GRCh38)
Location 11:36273985-36274007 11:36274017-36274039
Sequence CCAATTATTCCCACTTCTTCACC CTGCATTAGATGAAGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 284} {0: 1, 1: 0, 2: 1, 3: 25, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!