|
Left Crispr |
Right Crispr |
| Crispr ID |
1080881476 |
1080881486 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:36325314-36325336
|
11:36325361-36325383
|
| Sequence |
CCCTGCTGGATCTGGAGGGTTGG |
TAGCAAACGGCAGTGGTGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 30, 2: 84, 3: 144, 4: 321} |
{0: 1, 1: 2, 2: 73, 3: 120, 4: 170} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|