ID: 1080900368_1080900377

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1080900368 1080900377
Species Human (GRCh38) Human (GRCh38)
Location 11:36484121-36484143 11:36484169-36484191
Sequence CCATCCGAGGTTTCACTGCCATT CCGTGCATGCTGATGGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78} {0: 1, 1: 0, 2: 1, 3: 14, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!