ID: 1081069731_1081069741 |
View in Genome Browser |
Spacer: 24 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1081069731 | 1081069741 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 11:38595818-38595840 | 11:38595865-38595887 |
| Sequence | CCCTGCTGGATCCAGAGGGATGG | CAGCAAATAGCAGTGGTGGATGG |
| Strand | - | + |
| Off-target summary | No data | {0: 4, 1: 31, 2: 89, 3: 128, 4: 268} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||