ID: 1081078177_1081078180

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1081078177 1081078180
Species Human (GRCh38) Human (GRCh38)
Location 11:38702471-38702493 11:38702516-38702538
Sequence CCTCAGTTTCTTCATCTGTGAAG TTAAATATACAAATGGACAATGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 28, 3: 135, 4: 777}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!